Genome – What You Sequence Isn’t What You Get


ATCGGCTAATTAATATAATCGGCTAATTAATATAATCGGCTAATTAATATAATCGGCTAATTAATATAATCGGCTAATTAATATAATCGGCTAATTAATATAATCGGCTAATTAATATAATCGGCTAATTAATATAATCGGCTAATTAATATAATCGGCTAATTAATATAATCGGCTAATTAATATAATCGGCTAATTAATATAATCGGCTAATTAATATAATCGGCTAATTAATATA

Well, is this English? Yes and No. Yes for a layman and No for a geneticist. This is the language of GOD, if such a one exists. These are the alphabets and words that our cells speak. For a organic chemist these are complex molecules made of carbon, oxygen, hydrogen and nitrogen. For an intuitive counselor, these are the effects of the subtle field around us.

Our geneticist have managed to decipher this complex language. Is there a catch though? The effects of this genetic sequence or the human blueprint is what we see in terms of traits like blue eyes, black hair etc., This gene expression, which is the term used to describe the effects of the sequence, isn’t necessarily the same, even for identical twins.

genome 001

The language geneticist use is ‘phenotype’ for all external, observable traits of a gene sequence. They use the term ‘genotype’, for the gene sequence they observe and decrypt. So in other words, the identical genotypes doesn’t guarantee the same phenotype. The reverse is also true. Identical phenotypes doesn’t mean the same genotypes too. Let us see how we can account for this seeming anomaly.

Two persons with the same genotype could be exposed to different environmental conditions which include the diet, weather and the exposure to electromagnetic fields during the course of their stay on earth. Primary reason for the expression being different is the subtle field around us.

Popularly called as the Light field, this field is made of photons. The photons are the smallest units of the observable, material world. This L-field is composed of precise details. These details have the capacity to influence the genes and is the reason for the variance of the phenotype.

These L-fields also hold the key to programming our well-being. Someone who has been exposed to poor diet and shanty environment will surely have his gene expression affected severely. This is a proof that the subtle which is unseen, is indeed the all-powerful.

Can we then create our own reality? Are we really the masters of our own health and destiny? The answer is a resounding ‘Yes’. As we journey through this light age which is pushing the frontiers of cellular biology, quantum physics to its limits, we need to take responsibility for our personal fields.

You could have observed that certain places make you squirm with unease. There could be other places which make you peaceful and comfortable. These apply to bigger geographies too. The geo-field below us has magnetic qualities that produces good effects and sometimes bad consequences.

So while choosing your environment both physical and personal, exercise care. Your home could be heaven or hell, based on your choices you make. The people in your life with whom you share your field are important too. Remember they too have a share in your well-being just like you are for others.

It is time we raise ourselves to safeguard our subtle environment around us, which has such deep effects on our cells. The destiny of our earthlings could be re-written not only by decoding their genetic sequences but taking precise steps to keep our subtle environment in good shape.

  •  
  •  
  •  
  •  
  •  

Leave a Comment

Connect with:

Your email address will not be published. Required fields are marked *

You may use these HTML tags and attributes: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <s> <strike> <strong>